on targetplus non targeting control sirna pool  (Thermo Fisher)

Journal: Retrovirology

Article Title: ADAR1 enhances HTLV-1 and HTLV-2 replication through inhibition of PKR activity

doi: 10.1186/s12977-014-0093-9

Figure Lengend Snippet: ADAR1 proviral effect is mediated through inhibition of PKR activation. 293-T cells were transfected with 4 μg of (A) pACH or (B) pH6neo molecular clones and increasing amount (0, 5, 50, 500 ng) of ADAR1 plasmid. Western blot analyses were performed on 60 μg of proteins obtained from whole cell extracts using anti-ADAR1, anti-p24 gag , anti-Tax1, anti-Tax2, anti-PKR, anti-phospho-PKR and anti-actin antibodies. (C, D) : 293-T cells were transfected with siRNA directed against PKR (20nM) or with control siRNA. Twelve hours later cells were transfected with 20nM of the same siRNA together with 1.2 μg of (C) pACH, (D) pH6neo and 125 ng of an ADAR1 expression plasmid. Western blot analyses were performed on 60 μg of proteins obtained from whole cell extracts using anti-ADAR1, anti-p24 gag , anti-PKR, anti-phospho-PKR and anti-actin antibodies.

Article Snippet: The following day, 20 nM of PKR siRNA (ON-TARGETplus SMART pool EIF2AK2, Fermentas) or control siRNA (ON-TARGETplus Non-targeting Pool, Fermentas) were transfected (HiPerfect reagent, Qiagen) as previously described [ ].

Techniques: Inhibition, Activation Assay, Transfection, Clone Assay, Plasmid Preparation, Western Blot, Expressing

Journal: Nature communications

Article Title: CSN6 drives carcinogenesis by positively regulating Myc stability

doi: 10.1038/ncomms6384

Figure Lengend Snippet: (a) Immunoblot analysis of Csn6 +/− MEFs. Primary MEF cells were prepared from 13.5-day embryos derived from wild-type (wt) Csn6 +/+ and Csn6 +/− mice. After 4 days of culture, cell lysates were analyzed by indicated antibodies. (b) Quantitative RT-PCR analysis of mRNA levels for indicated c-Myc target genes in CSN6-transfected U2OS cells or Csn6 +/− MEFs. The quantitated mRNA expression level was normalized to GAPDH mRNA. Two MEFs were examined for each genotype. Expression level of transfected CSN6 is indicated as numbers on the heat map, and the heat map depicts the natural logarithm of fold-change in mRNA expression. (c) CSN6 knockdown abrogated serum-induced elevation of Myc. Csn6 +/+ MEFs and Csn6 +/− clone 1 (C1) and clone 2 (C2) MEFs were serum-starved for 24 hours and then were refed with serum for 24 hours. Lysates were analyzed by indicated antibodies. (d) CSN6 decreased Myc turnover. 293T cells were transfected with Flag-CSN6 and were then treated with cycloheximide (CHX; 100 µg/ml) for the indicated times. The immunoblot of Myc signal at each time point was measured using a densitometer and the integrated optical density of Myc was measured. The turnover of Myc is indicated graphically. (e) CSN6 expression affected Myc turnover. 35 S–pulse-labeled HA-Myc protein was immunoprecipitated from indicated transfected 293T cell lysates. The mixture was separated by sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE) and the gel exposed to x-ray film. The density of HA-Myc was measured and the integrated optical density (OD) was measured. The turnover of HA-Myc is indicated graphically. (f) CSN6 decreased ubiquitination levels of Myc. 293T cells were transfected with indicated plasmids. Cells were treated with 50 µg/ml MG132 for 6 hours before harvest. The ubiquitinated Myc proteins were pulled down with anti-HA antibody and immunoblotted with anti-ubiquitin (Ubi) antibody. (g) CSN6 activated Myc transcriptional activity. The Tert-luc reporter containing a Myc response element (Ebox) was transfected with the Myc–expressing vectors and increasing amounts of the CSN6 expression vector or CSN6 shRNA plasmid into 293T cells. Relative luciferase activities are shown with error bars representing standard deviations. Each result shown is representative of 3 independent experiments. (h) CSN6 elevated expression of Myc target genes. Quantitative real-time RT-PCR analysis of Myc target gene expression, including CDC25A, Adm-1, and ODC-1, in indicated cells. The error bars represent 95% confidence intervals. Each result shown is representative of 3 independent experiments.

Article Snippet: CSN6 shRNA plasmid (#1:NM_006833.4-1084s1c1, #2: NM_006833.4-165s1c1), CSN5 shRNA plasmid (NM_006833.4-1084s1c1), and Luciferase shRNA Control Vector (SHC007) were purchased from Sigma-Aldrich and had these target sequences: CSN6 shRNA #1: CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG CSN6 shRNA #2: CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG CSN5 shRNA: CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG Luciferase shRNA: CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT For knocking down CSN6 in 293T cells, pSilencer 1.0-U6 plasmid containing Csn6 shRNA oligos (Sequence:ACGTGCAACACAATGAACCTTCAAGAGAGTTCATTGTGTTGCACGTTTTTTTCCGGTGCACGTTGTGTTACTTGGAAGTTCTCTCAAGTAACACAACGTGCAAAAAAATTAA) were cotransfected with indicated plasmids. siRNAs for Cullin-1 (ON-TARGETplus SMARTpool siRNA L-004086-00-0005) and siRNA control (ON-TARGETplus Non-targeting Pool), were purchased from Thermo Scientific Dharmacon.

Techniques: Western Blot, Derivative Assay, Quantitative RT-PCR, Transfection, Expressing, Labeling, Immunoprecipitation, Electrophoresis, SDS Page, Activity Assay, Plasmid Preparation, shRNA, Luciferase

Journal: Nature communications

Article Title: CSN6 drives carcinogenesis by positively regulating Myc stability

doi: 10.1038/ncomms6384

Figure Lengend Snippet: (a) CSN6 increased Fbxw7α turnover. 293T cells were infected with lentivirus to express CSN6 shRNA or luciferase control shRNA. The cells were then transfected with Flag-Fbxw7α and were then treated with cycloheximide (CHX; 100 µg/ml) for the indicated times. The density of Fbxw7α was measured and the integrated optical density (OD) was measured. The turnover of Fbxw7α is indicated graphically. (b) CSN6-mediated Fbxw7α downregulation was proteasome-dependent. 293T cells were cotransfected with indicated plasmids and were treated with or without 50 µg/ml MG132 for 6 hours. The cell lysates were then immunoblotted with the indicated antibodies. (c) CSN6 enhanced Fbxw7α ubiquitination through lysine 48 linkage. 293T cells were cotransfected with Flag-Fbxw7α with or without GFP-CSN6 plus His-ubiquitin wild type (wt), K63R mutant, or K48R mutant. Cells were treated with 50 µg/ml MG132 for 6 hours before harvest. The ubiquitinated Fbxw7α proteins were pulled down using Ni-NTA-agarose beads and detected with anti-Flag antibody. (d) An F-box domain deletion mutant of Fbxw7α was resistant to CSN6-mediated ubiquitination. 293T cells were cotransfected with GFP-CSN6, His-ubiquitin plus Flag-Fbxw7α wild-type or F-box domain deletion mutant (ΔF). Cells were treated with 50 µg/ml MG132 for 6 hours before harvest. The ubiquitinated Fbxw7α proteins were pulled down using Ni-NTA-agarose beads and detected with anti-Flag antibody. (e) Cullin-1 knockdown diminished CSN6-induced ubiquitination of Fbxw7α. 293T cells were transfected with siRNA Cullin-1 or siRNA control plus indicated plasmids. Cells were treated with 50 µg/ml MG132 for 6 hours before harvest. The ubiquitinated Fbxw7α proteins were pulled down using Ni-NTA-agarose beads and detected with anti-Flag antibody. (f) Cullin-1 neddylation was involved in CSN6-mediated downregulation of Fbxw7α. 293T cells were transfected with indicated plasmids plus increasing amounts of HA-dnUbc12. The levels of Nedd8-Cullin-1 and Nedd8-dnUbc12 were detected with anti-Nedd8 antibody.

Article Snippet: CSN6 shRNA plasmid (#1:NM_006833.4-1084s1c1, #2: NM_006833.4-165s1c1), CSN5 shRNA plasmid (NM_006833.4-1084s1c1), and Luciferase shRNA Control Vector (SHC007) were purchased from Sigma-Aldrich and had these target sequences: CSN6 shRNA #1: CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG CSN6 shRNA #2: CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG CSN5 shRNA: CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG Luciferase shRNA: CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT For knocking down CSN6 in 293T cells, pSilencer 1.0-U6 plasmid containing Csn6 shRNA oligos (Sequence:ACGTGCAACACAATGAACCTTCAAGAGAGTTCATTGTGTTGCACGTTTTTTTCCGGTGCACGTTGTGTTACTTGGAAGTTCTCTCAAGTAACACAACGTGCAAAAAAATTAA) were cotransfected with indicated plasmids. siRNAs for Cullin-1 (ON-TARGETplus SMARTpool siRNA L-004086-00-0005) and siRNA control (ON-TARGETplus Non-targeting Pool), were purchased from Thermo Scientific Dharmacon.

Techniques: Infection, shRNA, Luciferase, Transfection, Mutagenesis

Journal: Nature communications

Article Title: CSN6 drives carcinogenesis by positively regulating Myc stability

doi: 10.1038/ncomms6384

Figure Lengend Snippet: (a) Neddylation status of Cullin in gel filtration chromatography fractions from spleen extracts from Csn6 +/+ (wt) and Csn6 +/− mice. Extracts of spleen from CSN6 +/+ or Csn6 +/− mice (4 weeks old) were ground and subjected to lysis. Lysates were fractionated by gel filtration chromatography. Fractions were resolved by SDS-PAGE, followed by immunoblotting with indicated antibodies. Molecular size of eluted fraction is indicated above. (b) Non-neddylated Cullin was increased in Csn6 +/− mice. Extracts of spleen from CSN6 +/+ (wt) or Csn6 +/− mice were fractionated by gel filtration chromatography. Representative fractions 36–54 from (a) were resolved by SDS-PAGE, followed by immunoblotting with anti-Cullin-1, anti-CSN6, and anti-CSN5 antibodies. (c) CSN6 competed with CSN5 for binding to Cullin-1 and affected Cullin-1 neddylation. 293T cells were transfected with His-Cullin-1 plus increasing amounts of GFP-CSN6 or Myc-CSN5. The neddylated Cullin-1 proteins were pulled down using Ni-NTA-agarose beads and detected with anti-Nedd8 antibody. The lysates were also immunoprecipitated with CSN6 antibody or CSN5 antibody and were subjected to immunoblotting with anti-Cullin-1. (d) MPN domain of CSN6 had an important role in competing with CSN5 for Cullin-1 binding and affected Cullin-1 neddylation. 293T cells were cotransfected with indicated plasmids. The lysates were immunoprecipitated with anti-Flag or anti-CSN5 antibody and immunoblotted with the indicated antibodies. (e) Mutation of conserved residues in the MPN domain of CSN6 compromised CSN6’s capacity for competing with CSN5. 293T cells were cotransfected with indicated CSN6 MPN mutant plasmids. The lysates were immunoprecipitated with anti-Flag antibody and immunoblotted with indicated antibodies. (f) CSN6 antagonized CSN5 in regulating Cullin-1 neddylation. U2OS cells were infected with indicated lentivirus carrying CSN6 shRNA, CSN5 shRNA, or luciferase control shRNA. Cell lysates were immunoblotted with the indicated antibodies. (g) The chimeric protein 6N5C expressing the CSN6 MPN domain functioned like wild-type CSN6 in increasing Cullin-1 neddylation. 293T cells were cotransfected with indicated wild-type– and chimeric protein–expressing plasmids. The lysates were pulled down with Ni-NTA-agarose beads and immunoblotted with anti-Nedd8. (h) Both chimeric protein 6N5C and wild-type CSN6 decreased the stability of Fbxw7α in a dose-dependent manner. 293T cells were cotransfected with indicated plasmids. The lysates were immunoblotted with indicated antibodies.

Article Snippet: CSN6 shRNA plasmid (#1:NM_006833.4-1084s1c1, #2: NM_006833.4-165s1c1), CSN5 shRNA plasmid (NM_006833.4-1084s1c1), and Luciferase shRNA Control Vector (SHC007) were purchased from Sigma-Aldrich and had these target sequences: CSN6 shRNA #1: CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG CSN6 shRNA #2: CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG CSN5 shRNA: CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG Luciferase shRNA: CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTT For knocking down CSN6 in 293T cells, pSilencer 1.0-U6 plasmid containing Csn6 shRNA oligos (Sequence:ACGTGCAACACAATGAACCTTCAAGAGAGTTCATTGTGTTGCACGTTTTTTTCCGGTGCACGTTGTGTTACTTGGAAGTTCTCTCAAGTAACACAACGTGCAAAAAAATTAA) were cotransfected with indicated plasmids. siRNAs for Cullin-1 (ON-TARGETplus SMARTpool siRNA L-004086-00-0005) and siRNA control (ON-TARGETplus Non-targeting Pool), were purchased from Thermo Scientific Dharmacon.

Techniques: Filtration, Chromatography, Lysis, SDS Page, Western Blot, Binding Assay, Transfection, Immunoprecipitation, Mutagenesis, Infection, shRNA, Luciferase, Expressing